Sequence gapdh FR AACCCATCACCATCTTCCAG CACGACATACTCAGCACCAG NM_017008/4 74 myoD FR TCTGATGGCATGATGGATTACTAGTAGGCGGCGTCGTAG NM_176079/1 74 تجزيه وتحليل داده ها
داده هاي به دست آمده از دستگاه Real Time PCR كه به صورت CT (ميانگين CT براي هر نمونه) بودند، با استفاده از نرم افزار Excel به ΔΔct تبديل شدند، سپس با استفاده از فرمول ΔΔct-2 اعداد نهايي بهدست آمد. با انتقال اين اعداد به نرم افزار SPSS، ابتدا پرت بودن داده ها بررسي شد كه مشخص شد دادة پرتي وجود ندارد. سپس نرمال بودن توزيع داده ها با استفاده از آزمون Shapiro-Wilk ارزيابي و مشخص شد كه دادهها توزيع طبيعي دارند. سپس با استفاده از آزمونLevene مساوي
بودن واريان سها ارزيابي شد. نتايج اين آزمون نشان داد كه واريانس ها در عضلات نعلي و EDL همگن هستند. در ادامه از آزمونهاي آماري t يك نمونه براي تعيين اختلاف بين گروه كنترل (شاخص عدد 1 1 است) و گروههاي تجربي و براي تعيين اختلاف ميانگين در هر عضله (در ساعات 3 و 6 پس از تمرين مقاومتي) از آزمون t مستقل استفاده شد.
نتايج
در عضلة EDL مقدار بيان ژن myoD 3 و 6 ساعت پس از تمرين مقاومتي به ترتيب 36/2 و 56/1 برابر افزايش يافت (شكل 1)، اما نتايج آزمون t يكنمونه اي نشان داد كه تغيير بيان ژن myoD عضلة EDL نسبت به گروه كنترل در 3 (279/ P =) و 6 (111/ P =) ساعت پس از تمرين مقاومتي معنادار نيست.
همچنين مقدار t مستقل (711/) نشان داد كه بين 3 و 6 ساعت پس از تمرين مقاومتي تفاوت معناداري (513/ P =) در بيان ژن myoD وجود ندارد.

شكل1. تأثير يك جلسه تمرين مقاومتي بر بيان myod عضلة EDL در 3 و 6 ساعت پس از يك جلسه تمرين مقاومتي نسبت به سطح پايه [خط منقطع (گروه كنترل)]

شكل 2. نمايش محصول PCR ژن myoD عضلة EDL، از چپ گروه كنترل، گروه 3 ساعت، گروه 6 ساعت و gapdh

در عضلة نعلي مقدار بيان ژن myoD 3 و 6 ساعت پس از تمرين مقاومتي بهترتيب 9/0 و 58/1 برابر افزايش يافت (شكل 3)، اما نتايج آزمون t يك نمونه اي نشان داد كه تغيير بيان ژن myoD عضلة نعلي نسبت به گروه كنترل در 3 (59/ P =) و 6 (352/ P =) ساعت پس از تمرين مقاومتي معنادار نيست. همچنين مقدار t مستقل (79/1 -) نشان داد بين 3 و 6 ساعت پس از تمرين مقاومتي تفاوت معناداري (294/ P =) در بيان ژن myoD وجود ندارد.

شكل 3. تأثير يك جلسه تمرين مقاومتي بر بيان myod عضلة نعلي در 3 و 6 ساعت پس از يك جلسه تمرين مقاومتي نسبت به سطح پايه [خط منقطع (گروه كنترل)]

شكل 4. نمايش محصول PCR ژن myoD عضلة نعلي، از چپ گروه كنترل، گروه 3 ساعت، گروه 6
gapdh ساعت و

بحث و نتيجه گيري
نتايج تحقيق نشان داد كه بيان ژن myoD در پاسخ به يك جلسه تمرين مقاومتي در عضلة تندانقباض، متفاوت از عضلة كندانقباض است، درحالي كه بيان آن در عضلة EDL بيشتر از دو برابر افزايش نشان داد، هرچند معنادار نبود، اما بيان آن در عضلة نعلي تنها به 58/1 برابر در شش ساعت پس از تمرين رسيد. تحقيقات نشان داده اند كه مقدار myoD در عضلة نعلي تحت تأثير تمرينات استقامتي حاد (با پروتكل متفاوت) قرار نمي گيرد (12) كه با يافته هاي اين تحقيق همخواني دارد. اما پاسخ عضلة پهن جانبي اندكي متفاوت است. براي مثال پژوهش Vissing (2008) نشان داد كه يك جلسه فعاليت استقامتي (90 دقيقه تمرين دوچرخه سواري در 60 درصد VO2peakدر افراد سالم) موجب افزايش بيانmRNA فاكتورهاي MyoD در عضلة پهن جانبي مي شود (13). يك جلسه تمرين قدرتي نيز موجبافزايش بيان ژن myoD در عضلة پهن جانبي افراد جوان و پير، چهار ساعت پس از تمرين ميشود (7). شايان يادآوري است كه عضلة پهن جانبي در نمونه هاي انساني يك عضلة بينابيني محسوب مي شود، اما عضلة نعلي در رتها يك عضلة كاملاً كند بهحساب ميآيد (19). به نظر ميرسد تركيب نوع تار بر پاسخ اين ژن به تمرين تأثير مي گذارد. در تأييد اين ادعا در تحقيقي گزارش شد كه يك جلسه تمرين مقاومتي در عضلة پهن جانبي آزمودنيهاي انساني موجب افزايش بيان ژن moyD بلافاصله و شش ساعت پس از جلسة تمريني ميشود كه اين همزمان بود با افزايش mRNA ايزوفرمMHC IIa ، بلافاصله بعد از تمرين و همچنين افزايش mRNA ايزوفرمهاي MHC IIa ،MHC I و MHC IIx، شش ساعت پس از تمرين. در تحقيق ذكرشده مقدار بيان پروتئين ها نيز اندازه گيري شد. نتايج نشان داد كه مقدار پروتئين myoD، شش ساعت پس از تمرين افزايش معناداري مي يابد (20). ژن myoD تحت تأثير تمرينات بلندمدت نيز قرار ميگيرد. براي مثال Liu و همكاران در سال 2007 نشان دادند كه تمرينات قدرتي (شش هفته) در نمونه هاي انساني به طور معناداري سبب افزايش بيان ژن myoD در عضلة سه سر بازو (عضلة تندانقباض) مي شود (15).
برخي تحقيقات بيان ژن myoD را شش ساعت پس از تمرين دانستهاند (3)، اما برخي نتايج نيز خلاف اين ادعا را نشان ميدهد، براي مثال ديده شد كه يك جلسه تمرين مقاومتي شديد در عضلة پهن جانبي (نمونة انساني) بلافاصله پس از تمرين، مقدار بيان ژن myoD را 100 تا 400 درصد افزايش داد، اين در حالي بود كه تا 48 ساعت پس از تمرين، تغييري مشاهده نشد (21). در تحقيقي ديگر، يك جلسه تمرين قدرتي در عضلة بازكنندة پا در نمونه هاي انساني موجب افزايش بيان ژن myoD تا 8 ساعت پس از تمرين شد كه اين افزايش پس از 20 ساعت ناپديد شد (22). بهنظر ميرسد نوع عضله، نوع تمرين و مدل آزمودني بر بيان اين ژن تأثيرگذار است، به همين دليل تناقضاتي در نتايج وجود دارد.
البته بايد گفت برخي نتايج نيز افزايش بيان ژن myoD در اثر تمرينات (چه پاسخ، چه سازگاري) ورزشي را تأييد نكردهاند. براي نمونه ديده شد كه يك جلسه تمرين قدرتي در نمونههاي انساني بر بيان myoD عضلة پهن جانبي اثر معناداري ندارد (6). همچنين تمرين قدرتي به مدت هشت هفته بر بيان myoD mRNA پهن جانبي در نمونه هاي انساني (با سطح تستوتسترون طبيعي يا كاهش يافته) تأثير معناداري ندارد (23). در تحقيقي، Drummond (2008) نشان داد كه myoD در عضلة پهن جانبي، تحت تأثير يك جلسه تمرين (مقاومتي در نمونه هاي انساني) و مصرف محرك آنابوليكي (در آن ساعاتاندازه گيري) قرار نميگيرد (24)، كه اين يافتهها با يافتة تحقيق حاضر همخواني دارد، هرچندتفاوت هايي در مدل آزمودني (انساني و حيواني) و نوع پروتكل وجود دارد. علاوه بر تمرينات بدني، القاكنندة فعاليت هاي بدني (تحريك الكتريكي مزمن) يا كشش بهتنهايي نيز بر بيان myoD اثر دارند.
براي مثال Vissing (2005) گزارش كرد كه تحريك الكتريكي با فركانس 10 هرتز و 5 ثانيه استراحت (القاكنندة تمرينات استقامتي) موجب افزايش بيان تارهاي كند در پايان هفتة چهارم در عضلة درشت ني قدامي (تار تندانقباض) مي شود كه اين موضوع با افزايش بيان MyoD mRNA در همان زمان همراه بود (25)، يا 24 ساعت پس از كشش عضلة نعلي رت (26) مقدار MyoD افزايش يافت. از طرف ديگر تمريناتي كه موجب آسيب عضلاني شدند، بيان myoD را زياد تحت تأثير قرار ندادند. براي مثال در مدلهاي حيواني (رت) مشاهده شد كه يك جلسه تمرين تردميل فزاينده با شيب منفي (القاكنندة آسيب عضلاني) بر بيان MyoD mRNA عضلات نعلي و بازكننده ها اثر معناداري ندارد (27). هرچند گزارش شده كه بازسازي عضلات آسيبديدة نعلي رت با فعاليت هاي ورزشي ( فعاليتهاي شديد و اختياري) تشديد ميشود كه اين موضوع با افزايش مقدار پروتئين myoD همراه بود (28). افزايش بيان ژن myoD نشانة تكثير سلول هاي ماهواره اي است و تكثير اين سلولها زماني بيشتر مي شود كه آسيب (فارماكولوژي، پاتولوژي يا فعاليت هاي قدرتي) عضلاني رخ دهد (10). با وجود معنادار نبودن، اما 36/2 برابر افزايش در بيان ژن myoDاحتمالاً ناشي از اين موضوع است كه تمرين قدرتي (پروتكل اين تحقيق) توانسته موجب آسيب تمريني در عضلة EDL و فعال سازي سلولهاي ماهواره اي، به تبع آن افزايش ماركر اين سلولها يعني ژن myoD شود.
در تعميم يافتهها و اعلام نتايج پاياني اين موضوع كه آيا تمرين بر بيان ژن myoD عضله تأثير دارد، بايد به مدل آزمودني، نوع پروتكل، نوع عضله، سن آزمودني ها، روش هاي اندازهگيري بيان ژن دقت كرد، همچنين بايد پروسة پاسخ و سازگاري را از هم جدا كرد.

نتيجه گيري كلي
ژن myoD در عضلة تندانقباض نسبت به عضلة كندانقباض سريعتر و بيشتر تحت تأثير تمرين مقاومتي قرار مي گيرد، به طوري كه يك جلسه تمرين مقاومتي در ساعات اولية پس از تمرين موجب افزايش بيان 36/2 برابري اما غيرمعنادار ژن myoD در عضلات EDL مي شود. در همان زمان مقدارآن در عضلة نعلي كاهش مييابد. سپس در شش ساعت پس از تمرين مقدار بيان اين ژن در هر دوعضله يكسان مي شود. اين موضوع در شكل 5 نشان داده شده است.

شكل 5. روند تغييرات بيان ژن myoD در گروه كنترل 3 و 6 ساعت پس از يك جلسه تمرين مقاومتي در عضلة EDL و نعلي
تقدير و تشكر
اين مقاله حاصل رسالة دكتري گرايش فيزيولوژي ورزش گروه تربيت بدني دانشكدة علوم انساني دانشگاه تربيت مدرس است. از تمام دوستاني كه در انجام اين پژوهش با اينجانب همكاري كردند، صميمانه سپاسگزارم. همچنين از حمايت مالي دانشگاه تربيت مدرس بهدليل تأمين اعتبارات اين پژوهش سپاسگزاري مي شود.
منابع و مĤخذ
Megeney, L.A., et al., MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes & Development, 1996. 10(10): p. 1173-
1183.
Biressi, S. and T.A. Rando, Heterogeneity in the muscle satellite cell population. Seminars in Cell & Developmental Biology, 2010. 21(8): p. 845-854.
Hawke, T.J. and D.J. Garry, Myogenic satellite cells: physiology to molecular biology. J Appl Physiol, 2001. 91(2): p. 534-51.
Holterman, C.E. and M.A. Rudnicki, Molecular regulation of satellite cell function. Seminars in Cell & Developmental Biology, 2005. 16(4-5): p. 575-584.
Zammit, P.S., All muscle satellite cells are equal, but are some more equal than others? Journal of Cell Science, 2008. 121(18): p. 2975-2982.
Hameed, M., et al., Expression of IGF-I splice variants in young and old human skeletal muscle after high resistance exercise. The Journal of Physiology, 2002. 547(1): p. 247-254.
Raue, U., et al., Myogenic gene expression at rest and after a bout of resistance exercise in young (18-30 yr) and old (80-89 yr) women. J Appl Physiol, 2006. 101(1): p. 53-9.
Hughes, S.M., et al., MyoD protein is differentially accumulated in fast and slow skeletal muscle fibres and required for normal fibre type balance in rodents. Mech Dev, 1997. 61(1-2): p. 151-63.
Tamaki, T., et al., Limited myogenic response to a single bout of weightlifting exercise in old rats. Am J Physiol Cell Physiol, 2000. 278(6): p. C1143-52.
Snijders, T., L.B. Verdijk, and L.J.C. van Loon, The impact of sarcopenia and exercise training on skeletal muscle satellite cells. Ageing Research Reviews, 2009. 8(4): p. 328-338.
Schultz, E. and K.M. McCormick, Skeletal muscle satellite cells. Rev Physiol Biochem Pharmacol, 1994. 123: p. 213-257.

در این سایت فقط تکه هایی از این مطلب با شماره بندی انتهای صفحه درج می شود که ممکن است هنگام انتقال از فایل ورد به داخل سایت کلمات به هم بریزد یا شکل ها درج نشود

شما می توانید تکه های دیگری از این مطلب را با جستجو در همین سایت بخوانید

ولی برای دانلود فایل اصلی با فرمت ورد حاوی تمامی قسمت ها با منابع کامل

اینجا کلیک کنید

Smith, H.K., et al., Exercise-enhanced satellite cell proliferation and new myonuclear accretion in rat skeletal muscle. J Appl Physiol, 2001. 90(4): p. 1407-14.
Vissing, K., et al., Effect of sex differences on human MEF2 regulation during endurance exercise. Am J Physiol Endocrinol Metab, 2008.
294(2): p. E408-15.
Favier, F.B., H. Benoit, and D. Freyssenet, Cellular and molecular events controlling skeletal muscle mass in response to altered use. Pflugers Arch, 2008. 456(3): p. 587-600.
Liu, Y., et al., Response of growth and myogenic factors in human skeletal muscle to strength training. British Journal of Sports Medicine, 2007. 42(12): p. 989-993.
Godfrey, J., et al., Interrupted Resistance Training and BMD in Growing Rats. International Journal of Sports Medicine, 2009. 30(08): p. 579-584.
Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8.
Silver, N., et al., Selection of housekeeping genes for gene expression studies in the adult rat submandibular gland under normal, inflamed, atrophic and regenerative states. BMC Mol Biol, 2008. 9: p. 64.
Talmadge, R.J., Myosin heavy chain isoform expression following reduced neuromuscular activity: potential regulatory mechanisms. Muscle Nerve, 2000. 23(5): p. 661-79.
Willoughby, D.S. and M.J. Nelson, Myosin heavy-chain mRNA expression after a single session of heavy-resistance exercise. Med Sci Sports Exerc, 2002. 34(8): p. 1262-9.
Psilander, N., R. Damsgaard, and H. Pilegaard, Resistance exercise alters MRF and IGF-I mRNA content in human skeletal muscle. J Appl
Physiol, 2003. 95(3): p. 1038-44.
Vissing, K., J.L. Andersen, and P. Schjerling, Are exercise-induced genes induced by exercise? FASEB J, 2005. 19(1): p. 94-6.
Kvorning, T., et al., Suppression of testosterone does not blunt mRNA expression of myoD, myogenin, IGF, myostatin or androgen receptor post strength training in humans. The Journal of Physiology, 2006. 578(2): p. 579-593.
Drummond, M.J., et al., Aging differentially affects human skeletal muscle microRNA expression at rest and after an anabolic stimulus of resistance exercise and essential amino acids. Am J Physiol Endocrinol Metab, 2008. 295(6): p. E1333-40.
Vissing, K., et al., Gene expression of myogenic factors and phenotypespecific markers in electrically stimulated muscle of paraplegics. J Appl Physiol, 2005. 99(1): p. 164-72.
Peviani, S.M., et al., Short bouts of stretching increase myo-D, myostatin and atrogin-1 in rat soleus muscle. Muscle & Nerve, 2007. 35(3): p. 363370.
Miyata, T., S. Tanaka, and K. Tachino, MyoD and myogenin mRNA levels after single session of treadmill exercise in rat skeletal muscle. Journal of physical therapy science, 2009. 21(1): p. 81-84.


پاسخ دهید