طرح تجربي و برنامة تمريني
قبل و بعد از 8 هفته تمرين، همة آزمودنيها آزمونهاي توان، چابكي و سرعت را در سه روز متوالي بهمنظور بازگشت به حالت اوليه انجام دادند. هر دو گروه تمريني سه بار در هفته در روزهاي غيرمتوالي (شنبه، دوشنبه و چهارشنبه) به مدت 8 هفته بهطور دقيق و در شرايط كنترلشده تمرين كردند. قبل از هر جلسة تمريني، آزمودنيها در يك دوره گرم كردن 10 دقيقهاي شامل دويدن آرام، پرشهاي كوتاه با دو پا و كشش فعال شركت كردند و در مرحلة سرد كردن 5 دقيقه دويدن آرام و حركات كششي غيرفعال را بهمنظور بازگشت به حالت اوليه سريعتر انجام دادند.
تمرين مقاومتي
پروتكل تمرين مقاومتي سنتي با هدف افزايش قدرت و توان عضلاني، چابكي و سرعت دويدن بود. پروتكل تمرين مقاومتي بهصورت 6 دورز با 3 تكرار براي حركت اسكات پا با وزنههاي آزاد انجام گرفت. براي جلوگيري از كاهش حجم تمرين، آزمودنيها 5 دور اول را با 90 درصد 3 تكرار بيشينه و دور آخر را تا واماندگي انجام دادند (4). اصل اضافه بار پيش رونده به اين صورت بود كه آزمودنيها همزمان با افزايش قدرت عضلاني، مقدار وزنه راافزايش ميدادند. فاصلة استراحت بين دورها 5- 4 دقيقه بود.
جدول 2 – برنامة تمريني گروه تركيبي
فاصلة استراحت تكرار دور حركت زمان
5-4 دقيقه 3 6 اسكات با هالتر 4 هفتة اول
7-5 دقيقه 10 6 پرش واكنشي با جعبه 4 هفتة دوم

تمرين پليومتريك
در پروتكل تمرين پليومتريك حركت پرش واكنشي با جعبه (پرش سقوطي و بلافاصله پرش عمودي) به-صورت 6 دور با 10 تكرار انجام گرفت. حركت به اين صورت بود كه آزمودنيها ابتدا از روي يك جعبه روي زمين فرود ميآمدند و سپس پرش انفجاري به سمت بالا و روي جعبة ديگر را انجام ميدادند (40). در واقع، تمرين شامل فرود از يك جعبه و سپس پرش بهطور عمودي با سرعت و تا ارتفاع ممكن بود (31، 3). حركات پليومتريك حركات انفجاري و شامل حركات با افزودن وزنه و بدون وزنة اضافي هستند (1). در اين پژوهش از حركت بدون وزنة اضافي يعني تنها وزن بدن ورزشكار استفاده شد.
ارتفاع دو جعبه يكسان بود. براي تعيين ارتفاع جعبه، در مطالعة آزمايشي ابتدا آزمودنيها از سكوي 50 سانتيمتري شروع به تمرين كردند و ارتفاع جعبه تا جايي كه آزمودني ميتوانست پروتكل (10 × 6) را انجام دهد، افزايش مييافت. اصل اضافه بار در تمرينات از طريق افزايش ارتفاع جعبه صورت ميگرفت. به اين صورت كه با افزايش توان عضلات با ارتفاع جعبه متناسب با آن افزايش مييافت. در تمرين پليومتريك فاصلة استراحت بين دورها 7 – 5 دقيقه و فاصلة استراحت بين تكرارها 5 – 4 ثانيه بود. در گروه پليومتريك، بهمنظور كاهش فشار تمرين در جلسات نهم و هجدهم و در گروه تركيبي در جلسة نهم تمرين پليومتريك، ارتفاع جعبه به 75درصد جلسة قبل تقليل يافت. فاصلة بين دو جعبه متناسب با قد افراد تنظيم ميشد.
جدول 3 – برنامة تمريني گروه پليومتريك

در این سایت فقط تکه هایی از این مطلب با شماره بندی انتهای صفحه درج می شود که ممکن است هنگام انتقال از فایل ورد به داخل سایت کلمات به هم بریزد یا شکل ها درج نشود

شما می توانید تکه های دیگری از این مطلب را با جستجو در همین سایت بخوانید

ولی برای دانلود فایل اصلی با فرمت ورد حاوی تمامی قسمت ها با منابع کامل

اینجا کلیک کنید

فاصلة استراحت تكرار دور حركت زمان
7-5 دقيقه 10 6 پرش واكنشي با جعبه 8 هفته

شيوههاي اندازهگيري نمونة عضلاني
نمونة عضلاني بهوسيلة سوزن نازك (FNB) از روي پوست از عضلة پهن جانبي پاي برتر آزمودنيها و به-صورت عمقي توسط پزشك متخصص انجام گرفت. محل نمونهبرداري تقريباً در فاصلة 15 سانتيمتري بالاي كشكك بود. اين روش بيوپسي عضلاني جايگزيني براي بيوپسي عضلاني نيمه باز (روش برگستروم) است. بيوپسي عضلاني با سوزن نازك (بيوپسي ريز) حالت تهاجمي كمتري دارد و بهطور موفقيتآميزي براي گرفتن بافت عضلاني در چندين مطالعه استفاده شده است (11). نمونة عضلاني 3 روز قبل از شروع و 7 روز بعد از اتمام پروتكل انجام گرفت (20). نمونهها به سرعت در داخل تيوب مخصوص گذاشته شده و در داخل نيتروژن مايع براي آزمايشهاي بعدي قرار داده ميشد.
توان عضله
براي اندازهگيري توان از سه آزمون سارجنت (18)، پرش جفت و بوسكو (5 و 60 ثانيهاي) (Satrap Ego jump test ،company Iran) استفاده شد. ابتدا آزمودنيها با استفاده از روشهاي كشش فعال خود را گرم كردند. سپس آزمون سارجنت و بعد از 5 دقيقه استراحت آزمون پرش جفت را اجرا كردند. آزمودنيها بعد از اجراي اين آزمون، به مدت 10 دقيقه استراحت كردند، سپس آزمون 5 ثانيهاي بوسكو (پرش مداوم) (5CJ) و به فاصلة 10 دقيقه بعد آزمون 60 ثانيهاي بوسكو (60CJ) را انجام دادند. در آزمون بوسكو، به آزمودنيها گفته مي-شد تا حد ممكن، تواليهاي مداوم پرش را بدون وقفه به مدت 5 يا 60 ثانيه اجرا كنند. هدف اين آزمون ارزيابي ظرفيت دستگاههاي متابوليكي و عصبي عضلاني است كه فعاليت عضله در خلال تلاش با شدت بالا را حفظ ميكند (19).
چابكي و سرعت
براي اندازهگيري چابكي از آزمون مانع ششضلعي استفاده شد. هدف اين آزمون اندازهگيري چابكي در جابه- جايي است. ابتدا آزمودني در مركز ششضلعي قرار ميگرفت و با پرش جفتي به بيرون هر ضلع و برگشت به نقطة مركز در جهت عقربههاي ساعت محيط ششضلعي را سه بار طي ميكرد. اين عمل دو بار اجرا و زمان با دقت 01/0 ثانيه ثبت ميشد و در نهايت ميانگين دو زمان اجرا محاسبه ميشد. براي اندازهگيري سرعت از آزمون دو سرعت 35 متر استفاده شد. اين آزمون به اين دليل انتخاب شد كه در بين آزمونهاي سرعت معتبرتر است. از آزمودني خواسته ميشد سه بار آزمون را تكرار كند. سريعترين (كمترين زمان) براي مقايسة پيشآزمون و پسآزمون استفاده شد (31).
برآورد بيان ژنهاي IGF-I و MGF
براي برآورد بيان ژنهاي IGF-1 و MGF از روش real – time reverse transcriptase PGR استفاده شد. پرايمرهاي استفادهشده براي PCR مربوطه در جدول 4 خلاصه شده است.
جدول 4 – تواليهاي پرايمر براي ژنهاي هدف مربوط
Expected
PCR
Product
(bp) Reverse-Primer Forward-Primer ژن هاي هدف
155 5`-
ATGTCACTCTTCACTCCTCAG-
3` 5`-CCCAAGACCAGAAGGAAG3` IGF-1
106 5`-TGCTCCTCTCTCATCATCC-
3` 5`-
CCAAGACCCAGAAGTATCAG3` MGF
131 5`-
GTAGTTTCGTGGATGCCACA-
3` 5`- TCCCTGGAGAAGAGCTACG-
3` -actin
از بافت هموژنيزه شده، تخليصRNA با استفاده از كيت MV صورت گرفت، سپسcDNA از
RNAهاي استخراجشده بهدست آمد. همچنين ژن مرجع داخلي، بتا اكتين با تعداد كپي مشخص بود. پروتكل
real time reverse transcriptase PCR براي MGF ، IGF-I و بتا اكتين در جدول 5 آمده است. به-علاوه محصولات PCR از طريق به جريان انداختن الكتروفورز بر روي ژل آگارز 1 درصد براساس اندازه و خلوص
DNA تصدي شدند (شكل 1).

بتا آكتين MGF و IGF-1 ژنهاي real time reverse transcriptase PCR جدول 5 – چرخة دمايي
دما (C) زمان تكرار
94 3 دقيقه 1 سيكل
94
58
72 20 ثانيه
30 ثانيه
50 ثانيه 40 سيكل
72 10 دقيقه 1 سيكل

شكل 1 – بررسي تكثير ژن با روش PCR و الكتروفورز با ژل آگارز (1 درصد) در نمونه هموژن عضله، ستون 1: β-actin، ستون 2: MGF و ستون 3: IGF-1
آناليز كمي مقدار بيان ژن
در اين تحقيق از روش relative standard curve استفاده شد و بازده هر ژن در محاسبات لحاظ شد (20). در اين آزمايش ژنهاي IGF-1 و MGF بهعنوان ژن هدف و ژن β-actin بهعنوان كنترل دروني در نظر گرفته شد و نمونة كنترل كه سلول فاقد پلاسميد است، بهعنوان نمونة مرجع يا كاليبراتور در نظر گرفته شد، فرمول بهكار رفته در زير آورده شده است:
Expression Ratio= ETarget (Ct Control-Ct Target) /EReference (Ct Control-Ct Target) شمارة چرخهاي است كه در آن منحني تغييرات ميزان فلورسانس CT و PCR معرف كارايي E كه در آن .هر نمونه، خط آستانه را قطع ميكند

روشهاي آماري
نتايج آزمون كلموگروف – اسميرونوف نشان داد كه دادهها از توزيع طبيعي برخوردارند، بنابراين براي تجزيهوتحليل آنها از آزمونهاي پارامتريك استفاده شد. براي بررسي اختلاف پيشآزمون و پسآزمون در هر دو گروه از آزمون t زوجي و براي بررسي اختلافات احتمالي بين دو گروه در پيشآزمون و پسآزمون از آزمون t مستقل استفاده شد. براي بررسي اينكه كدام پروتكل تمريني (پليومتريك يا تركيبي) تغيير بيشتري ايجاد كرده،از درصد تغييرات نسبت به پيشآزمون استفاده شد. اختلاف معنادار آماري نيز در سطح 05/0 ≤P تعيين شد.

نتايج و يافته هاي تحقيق
نتايج پيشآزمون، پسآزمون و درصد تغييرات به تفكيك گروهها در جدول 6 نشان داده شده است. هر دو گروه در پيشآزمون اختلاف معناداري نداشتند (05/0 ≥P)، اما در پسآزمون اختلاف معناداري در آزمونهاي پرش جفت (023/0 ≤P) و چابكي (015/0 ≤P) بين گروه پليومتريك و تركيبي مشاهده شد.
توان هر دو گروه در آزمونهاي سارجنت (001/0 ≤P1 و 001/0 ≤P2)، پرش جفت (001/0 ≤P1 و 20/0≤P1≤ 0/001) CJ5 ،(P2 و 001/0 ≤P2) و P1≤ 0/001) CJ60 و 006/0 ≤P2)، پيشرفت داشتند اما درصد تغييرات در گروه پليومتريك بيشتر از گروه تركيبي بود. در بين آزمونهاي توان، بيشترين پيشرفت در آزمون پرشي سارجنت (درصد تغييرات در گروه پليومتريك (51/24 درصد) و در گروه تركيبي (24/11 درصد) مشاهده شد.
چابكي
هر دو گروه در زمان اجراي اين آزمون كاهش معناداري مشاهده شد (001/0 ≤P)، درصد تغييرات در گروه پليومتريك 62/21- و در گروه تركيبي 98/16- بود.
سرعت
در آزمون دو سرعت 35 متر هر دو گروه كاهش زمان را نشان دادند (01/0 ≤P) درصد تغييرات در گروه پليومتريك 63/2- و در گروه تركيبي 18/1- بود.
عامل رشد مكانيكي
در گروه اول، مقدار بيان ژن MGF كاهش غيرمعنادار (18/20 درصد، 29/0 ≤P) و در گروه دوم افزايش معناداري را نشان داد (24/159 درصد، 04/0 ≤P).
عامل رشد شبهانسولين -1
در گروه اول مقدار بيان ژن IGF-I بهطور معنادار (83/133 درصد، 04/0 ≤P) و در گروه دوم به طورغيرمعنادار افزايش يافت (06/24 درصد، 16/0 ≤P).
جدول 6 – دادههاي توصيفي قبل و بعد از تمرين و سطح معناداري (ميانگين و انحراف معيار)
سطح معناداري درصد تغييرات پس آزمون پيش آزمون گروه متغير
P≤ 0/29 P≤ 0/04 -20/18
159/24 12/66 ± 6/22
8/14 ± 5/28 15/86 ± 3/85
3/14 ± 4/48 اول
دوم MGF
(AU)
P≤ 0/04
P≤ 0/16 133/83
24/06 32/90 ± 18/10
20/68 ± 21/28 14/07 ± 11/58
16/67 ± 18/53 اول
دوم IGF-I
(AU)
P≤ 0/001
P≤ 0/001 24/51
11/24 63/14 ± 8/99
55/14 ± 8/93 50/71 ± 4/68
49/57 ± 10/9 اول
دوم سارجنت (سانتي متر)
ادامة جدول 6 – دادههاي توصيفي قبل و بعد از تمرين و سطح معناداري (ميانگين و انحراف معيار)
سطح معناداري درصد تغييرات پس آزمون پيش آزمون گروه متغير
P≤ 0/001
P≤ 0/001 15/79
10/09 47/14 ± 5/87
46/71 ± 8/26 40/71 ± 6/18
42/43 ± 9/5 اول
دوم CJ5
(ثانيه)
P≤ 0/001 P≤ 0/006 13/08
7/03 34/57 ± 3/1
32/57 ± 8/5 30/57 ± 3/95
330/43 ± 8/72 اول
دوم CJ60
(ثانيه
P≤ 0/001
P≤ 0/20 10/79
4/46 269/86 ± 12/05
231 ± 39/59 243/57 ± 16/09
221/14 ± 42/57 اول دوم پرش جفت
(سانتي متر)
P≤ 0/001
P≤ 0/001 -21/62
-16/98 10/48 ± 0/57
12/66 ± 1/73 13/37 ± 0/98
15/25 ± 3/65 اول چابكي (ثانيه)
دوم
P≤ 0/01
P≤ 0/01 -2/63
-1/18 4/82 ± 0/13
5/01 ± 0/45 4/95 ± 0/2
5/07 ± 0/46 اول دو سرعت (ثانيه) دوم
AU : واحد اختياري

بحث و نتيجهگيري
تارهاي عضلة اسكلتي توانايي چشمگيري براي تغيير فنوتيپ خود در پاسخ به محركها، اختلالهاي محيطي (5) و شرايط فشارزا (31) دارند. در پاسخ به عوامل بالا عضلة اسكلتي تعدادي فرايندهاي سلولي شامل نوسازي، هايپرتروفي و دگرگوني تار عضله را متحمل ميشود. يكي از سازوكارهاي مسئول اين فرايندهاي سلولي، فعالسازي سلولهاي ماهوارهاي است كه از طريق عوامل رشد تنظيم ميشود (21). هايپرتروفي يك عضلة فرايندي چندبعدي شامل عواملي مانند عوامل رشد (IGFs ،(GFs، سلنيوترول، استروئيدهاي آنابوليك، هورمونها، سيستم ايمني و سلولهاي ماهوارهاي است (5). در تحقيق حاضر دريافتيم كه 8 هفته تمرين تركيبي (مقاومتي و پليومتريك) و تمرين پليومتريك به پاسخهايي در IGF-1 و MGF و آزمونهاي عملكردي منجر شد. بهعلاوه پاسخ اين پارامترها بهطور مشخص بين گروهي كه صرفاً تمرين پليومتريك انجام داده بودند و گروهي كه تمرين مقاومتي نيز انجام داده بودند، متفاوت بود.
در گروه اول همة پارامترها به جز MGF افزايش معناداري را نشان دادند، درصورتيكه در گروه دوم همة پارامترها به جز IGF-1 و توان بي هوازي (پرش جفت) تغييرات معناداري را نشان دادند. نتايج پژوهش حاضر به خوبي نشان ميدهد كه IGF-1 و MGF در رشد عضلة ناشي از تمرين مقاومتي و پليومتريك نقش متمايز و بسزايي دارند. اين نقش متمايز در تحقيقات ديگر نيز تصديق شده است (9).
تا آنجا كه ما ميدانيم، پژوهش حاضر اولين تحقيقي است كه پاسخ عوامل رشد (IGF-1 و MGF) به تمرين پليومتريك و تركيب آن با تمرين مقاومتي را بررسي كرده است و پاسخ عوامل رشدي نيز به نوعي دو روش تمريني بالا را از نظر ماهيت و نوع فشاري كه بر اجزاي مقدار مختلف سيستم عضلاني وارد ميكنند، تفكيك كرده است. كا. ام. هينمير و همكاران (2007) تأثير تمرين قدرتي كوتاهمدت (4 روز) را بر مقدار بيان ايزوفرمهاي IGF-1 در عضلة موش بررسي كردند. آنها دريافتند كه IGF-IEa و MGF در عضله تا 15 برابر در پاسخ به تمرين افزايش يافت. بهعلاوه در عضله، اثر تمرين برونگرا بيشتر از تمرين درونگرا براي هر دو IGF-IEa و MGF بود و براي IGF-IEa تمرين ايزومتريك اثر بيشتري نسبت به تمرين درونگرا داشت. چارلس پي لامبرت و همكاران (2 008) نشان دادند كه 12 هفته تمرين تركيبي (تركيب تمرين مقاومتي و هوازي) mRNA MGF را تقريباً دو برابر افزايش ميدهد. آنها همچنين گروه ديگري داشتند كه 12 هفته برنامةكاهش وزن را بدون ورزش دنبال كردند. در اين گروه mRNA MGF افزايش پيدا نكرد.
نتايج تحقيقات هينمير و همكاران و چارلس و همكاران موافق با نتايج پژوهش حاضر نشان ميدهد كه تمرين مقاومتي بيان mRNA MGF را افزايش ميدهد. نتايج تحقيق چارلس نشان ميدهد كه فقط در نتيجة فشار مكانيكي بيان ميشود و تأييدي بر اين موضوع است كه mRNA MGF فقط در عضلة اسكلتي بيان ميشود (23، 9). حامد و همكاران (2008) بيان دو گونة پيرايشيافته از عامل رشد شبهانسولين -1، IGF-IEa و MGF در پاسخ به يك ساعت ورزش برونگرا روي دوچرخة كارسنج در افراد جوان و مسن را بررسي كردند. آنها نشان دادند كه ميانگين mRNA MGF نه mRNA IGF -IEa ، در هر دو گروه بهطور معناداري افزايش يافت و نتيجه گرفتند كه گونة پيرايشيافتة به ورزش آسيبزا حساس است و در مقايسه با IGF-IEa بهطور متفاوتي تنظيم ميشود.
عامل رشد مكانيكي در عضله در پاسخ به اضافه بار مكانيكي، آسيب بافت و ورزش افزايش مييابد. در اين شرايط، ژن IGF-1 اغلب MGF و سپس به گونة پيرايشيافتة IGF-IEa پيرايش ميشود (15، 9، 2). ام رويچ و همكاران (2009) در فراآناليزي تمرين برونگرا را با تمرين درونگرا مقايسه كردند و نشان دادند كه در مورد قدرت و هايپرتروفي، آزمودنيها بيشتر از تمرين برونگرا سود بردند. همسو با اين فراآناليز، ماتياس مولر و همكاران (2009)، مارسلو سالدانها اوكي (2006) و ماتيو پريمان (2009) نشان دادند كه تمرين مقاومتي و به- ويژه تمرين برونگرا بار مكانيكي بيشتري بر عضله وارد ميكند. تحقيقات نشان ميدهند كه اثر تغذيهاي ورزش مقاومتي نه تنها شامل فشار مكانيكي زياد، بلكه همچنين شامل عوامل متابوليكي، هورموني و عصبي است (29، 25). در نتيجه بهنظر ميرسد بار مكانيكي تمرين مقاومتي بيشتر از تمرين پليومتريك است. به هر حال، باتوجه به پيشينة موجود بهنظر ميرسد كه MGF بيشتر به محركهاي مكانيكي پاسخگوست (28، 25، 22، 21، 14، 7). موافق با آنچه در ادبيات موجود است.
در پژوهش حاضر باتوجه به اينكه محركهاي مكانيكي در پروتكل تمرين تركيبي بيشتر از پروتكل تمرين پليومتريك بوده است، شايد توجيهي براي افزايش بيشتر MGF در گروه تركيبي باشد.

عوامل رشد به محركهاي مكانيكي و سوختوساز انرژي در عضله نيز حساسند (21، 13) و اين دو عامل درپروتكلهاي تمريني پژوهش حاضر احتمالاً باتوجه به ماهيت حركت، سرعت اجراي حركت، تعداد تكرارها و ميزان تغييرات زاوية زانو در خلال اجراي حركت متفاوت بوده است. تمرين پليومتريك توان انفجاري (36، 27) و سرعت واكنش را بهبود ميبخشد كه به بهبود واكنشپذيري سيستم عصبي مركزي مربوط ميشود. علاوهبر ويژگيهاي انقباضي و الاستيكي عضله، بهبود گيرندههاي داخلي عضله و تحمل براي كشش، سازگاري عملكردهاي عصبي – عضلاني و سوختوسازي در بيتمرين پليومتريك بهوجود ميآيد.
روش تمريني پليومتريك مهار بازتابي عضله را كاهش و حساسيت اندامهاي گلژي تاندون را افزايش ميدهد. همچنين حساسيت دوكهاي عضله را بهبود ميبخشد و تنش عضله را افزايش ميدهد (27). به هر حال بهنظر ميرسد عوامل ديگري علاوهبر ويژگيهاي انقباضي عضله، در سازگاري به تمرين پليومتريك نقش دارند. بنابراين ممكن است اجزاي انقباضي تارهاي عضلاني در مقايسه با تمرين مقاومتي در تمرين پليومتريك كمتر تحريك شوند و اين شايد دليلي براي افزايش بيشتر mRNA MGF در گروه تركيبي پژوهشي حاضر باشد. در مقابل اين احتمال نيز وجود دارد كه در سازگاري به تمرين پليومتريك، ويژگيهاي الاستيكي عضله، ويژگيهاي عصبي و اصل شبيهسازي حركت سهم بسزايي داشته باشند.
كريستين ويسينگ و همكاران (2008) نشان دادند كه تمرين مقاومتي و پليومتريك هر دو سطح مقطع عرضي عضله را افزايش ميدهند، درصورتيكه سطح مقطع عرضي تارهاي عضله (نوع 1 و 2) تنها در نتيجة تمرين مقاومتي افزايش مييابد (16). اين نتيجه گواه آن است كه احتمالاً تمرين پليومتريك هايپرتروفي اجزاي انقباضي تار عضله را تحت تأثير قرار نميدهد و احتمالاً افزايش سطح مقطع عرضي كل عضله مديون افزايش اجزاي الاستيكي و غيرانقباضي عضله است. در تحقيق حاضر شايد عدم افزايش mRNA MGF در گروه پليومتريك در نتيجة عدم ايجاد فشار مكانيكي چشمگير در اجزاي انقباضي تارهاي عضله باشد.
باتوجه به نتايج پژوهش حاضر و ديگر تحقيقات ميتوان نتيجه گرفت كه در سازگاري عضلاني به تمرين مقاومتي و پليومتريك طولانيمدت (8 هفته) بيان عوامل رشد دخيلند و هر كدام از رونوشتهاي ژن IGF-1 (IGF-IEa و MGF) بهطور متفاوتي به اضافهبار مكانيكي و سوختوسازي پاسخ ميدهند. در تحقيق حاضر چابكي، توان بي هوازي و سرعت نيز در هر دو گروه افزايش يافت كه مؤيد مؤثر بودن دو پروتكل تحقيق حاضر درافزايش عوامل بالا و پاسخ دستگاههاي عصبي – عضلاني و در نهايت سازگاري آنهاست.
منابع و مĤخذ
Alan, P. Jung. (2003). “The impact of resistance training on distance running performance”. Sports Med. 33 (7). PP. 549-552.
Anastassios Philippou et al (2007). “The role of the insulin – like growth factor 1 (IGF-1) in sketetal muscle physiology”. In vivo 21. PP:45-54.
Avery, D. Faigenbaum. James E. Mcfarland. (2007). “Effects of a short – term plyometric and resistance training program on fitness performance in boys age 12 to 15 years old”. Journal of sports science and medicien: 6. PP: 519-525.
Benson, C. D. Docherty, J. Brandenburg. (2006). “Acute neuromuscular responses to resistance training performed at different loads”. Journal of science and medicine in sport, 9. PP: 135-142.
Boonyarom, O. and Inui. K. (2006). “Atrophy and hypertrophy of skeletal msucles: structural and functional aspects”. Acta physiol, 188.PP: 77-89.
Charles, P. Lambert, Nicole R. Wright, Brian N. Finck, and Dennis T. Villareal. (2008). “Exercise but not diet – induced weight loss decreases skeletal muscle inflammatory gene expression in frail obese elderly persons”. Journal of applied physiology, 105:PP: 473-478.
Geoffrey Goldspink (2005). “Mechanical signals. IGF-1 gene splicing and muscle adaptation”. Physiology, 20: PP:232-238.
Hameed M, Orrell RW, Cobbold M. Goldspink G. and Harridge SD. (2003). “Expression of IGF-1 sptice variants in young and old human skeletal muscle after high resistance exercise”. J Phyiol 547: PP:247-425.
Hameed, M. A. D. Tofi, B. K. Pedersen, S. D. R. Harridge, G. Goldspink. (2008). “Effects of eccentric cycling exercise on IGF-1 splice variant expression in the muscles of young and elderly people”. Scand J Med Sci Sports. 18: PP:447-452.
Hameed, M. and Lange K. H. W. et al (2003). “The effect of recombinant human growth hormone and reistance training on IGF-1 mRNA expression in the muscles of elderly men”. J Physiol 555. 1. PP: 231-240.
Hayot, M. et al (2005). “Skeletal muscle microbiopsy: a validation study of a minimalty invasive technique”. Eur Respir J. 25: PP:431-440.
Heinemeier, K. M. et al (2007). “Short – term strength training and the expression of myostatin and IGF-1 isoforms in rat muscle and tendon: differential effects of specific contraction types”. J Appl Physiol. 102: PP:573581.
Heinmeter KM. Kjaer, M. (2011). “In vivo investigation of tendon responses to mechanical loading”. J Musculoskelet Neuronal Interact: 11 (2). PP:115-123.
Irina, V. Kravchenko, Vladimir, A. Furalyov, Eugenia, S. Lisitsina, Vladimir, O. Popov. (2011). “Stimulation of mechano – growth factor expression by second messengers”. Archives of biochemistry and biophysics. 507. PP:323331.
Joanaa, Riddoch. Contreras, Shi – Yu Yang, James R. T. Dick, Geoffrey Goldspink, Richard W. Orrell, linda Greensmith (2009). “Mechano – growth factor, an IGF-1 splice variant, rescues motoneurons and improves muscle function in SODIG93A mice”. Experimental neurology. 215. PP:281-289.
Kristian Vissing, Mads Brink and Simon Lonbro. (2008). “Muscle adaptations to ploymetric vs. resistance training in untrainel young men”.
Journal of strength and conditioning research. 22(6). PP: 1799-1810.
Kyle, L. Flann, Paul, C. LaStayo, Donald, A. McClan, Mark Hazel and Stan, L. Lindstedt. (2011). “Muscle damage and muscle remodeling: no pain, no gain?” The journal of experimental bilogy 214, PP:674-679.
John Cronin, Peter, J. Mcnair, Robert N Marshall. (2001). “Velocity specificity and combination training an sport specific tasks”. Journal of science and medicine in sport: 4(2). PP: 168-178.
Juliano Dal Pupo, Francimara Budal Arins. (2010). “Neuromuscular indices associated with 200 and 400 m sprint running performance”. Motriz, Rio Claro, Vo. 16, No. 2, PP: 395-401.
Liu, Y. A. Schlumberger, K. Writh, D. Schmidtbleicher and J. M. Steinacker. (2003). “Different effects on human skeletal mysosin heavy chain isoform expression: strength vs. combination training”. J Appl Physiol 94: PP: 2282-2288.
Liu, Y. Heinichen, M. Wirth, K. Schmidtbleicher D. and Steinacker, J. M. (2008). “Response of growth and myogenic factors in human skeletal muscle to strength training”. Br. J. Sports. Med. 42: PP: 989-993.
Marcelo Saldanha Aoki, Elen Haruka Miyabara. (2006). “mTOR pathway inhibition attenuates skeletal muscle growth induced by stretching”. Cell Tissue Res. 324: PP: 149-156.
Maria Hill and Geoffrey Goldspink. (2003). “Expression and splicing of the insulin – like growth factor gene in rodent muscle is associated with muscle satellite (stem) cell activation following local tissue damage”. J. Physiol. 549. 2, PP: 409-418.
Mari Imanaka, et al. (2008). “Growth hormone stimulates mechano growth factor expression and activates myoblast transformation in C2C12 cells”. Kobe J. Med. Sci. Vol. 54, No. 1, PP: 46-54.
Matthew perryman. (2009). “Maximum muscle: the science of intelligent physique development”. J. Musculoskeletal Neruronal Interact; 7(3); PP:219225.
Matthias, Mueller, Fabio Andras Breil et al (2009). “Different response to eccentric and concentric training in older men and women”. Eur J Appl Physiol, 107: PP:145-153.
Michal Lehnert, Ivono Lamrova, Milan Elfmark (2009). “Changes in speed and strength in female volleyball players during and after plyometric training program”. Acta Univ. Palacki. Olomuc. Gymn. Vol. 39, No. 1.
Michael Aperghis, Cristiana, P. Velloso, Mahjabeen Hameed, Theresa Brothwood, Lloyd Bradley, Pierre M. G. Bouloux, Stephen D. R. Harridge Geoffrey Goldspink. (2009). “Serum IGF-1 levels and IGF-1 gene splicing in muscle of healthy young males receiving rhGH”. Growth hormone and IGF research 19, PP:61-67.
Michiya Tanimoto and Naokata Ishii. (2006). “Effects of low – intensity reistance exercise with slow movement and tonic force generation on muscular function in young men”. J Appl Physiol. 100. PP: 1150-1157.
Nathalie Koulmann, Andre – Xavier Bigard. (2006). “Interaction between signaling pathway involved in skeletal muscle responses to endurance exercise”. Eur J Physio: 452, PP:125-139.
Nicole J. Chimera, Kathleen A. Swanik, and Swanik, C. Buz Swanik and Stephen. J. Straub. (2004). “Effects of plyometric training on muscle – activation strategies and performance in female athletes”. Journal of athletic training. 39 (1). PP: 24-31.
Philippou, A. Halapas, A. Maridaki, M. and Koustsilieris, M. (2007). “Type 1 insulin – like growth factor receptor signaling in skeletal muscle regeneration and hypertrophy”. J Musculoskelet neuronal interact. 7 (3).
PP:208-218.
Ravio, Puhke. Sirkka Aunola, Pire Ailanto, Karin Alev, Mika Venojarvi, Heikki Rusko and Teet Seene. (2006). “Adaptive changes of mysosin isoforms in response to long – term strength and power training in middle aged men”. Journal of sports science and medicine, 5. PP:349-358.
Kohnke, Richard and Henriette Pilegaard (2005). “Effect of resistance exercise and post exercise nutrient intake on plasma IGF-1 level plus MRF, MHC, myostatin and IGF-1 gene expression in human skeletal muscle”.J. App Physiol. 100;PP:1232-1243.
Roig, M. et al (2009). “The effects of eccentric versus concentric resistance training on muscle strength and mass in healthy adults: a systematic review with meta – analysis”. Br J Sports Med. 43: PP:556-568.
Shu – Lin Lee. Et al (2011). “Effect of passive repetitive isokinetic training on cytokines and hormonal changes”. Chinese journal of physiology. 54 (1). PP: 55-66.
Smolkina, Z. and Karus, A. (2004). “IGF-1 and some housekeeping gene candidates for real time RT- PCR expression studies in cattle”.BR.Y.Sport Medicine 49; PP:114-124
Sukho, Lee. (2003). Insulin – like growth factor – 1 induces skeletal muscle hypertrophy. Journal of exercise science and fitness. 1(1). PP: 47-53.


پاسخ دهید