از نردبان مقاومتی با یک متر ارتفاع و فاصلة میله های 1 سانتی متری با شیب 85 درجه استفاده و وزنه هااییکه با چسب نواری به دُُم موش های صحرایی نوار وصل می شد اساتفاده شاد. بعاد از یاک هفتاه آشناساازی باادستگاه تمرین مقاومتی، تمرین در هفتة اول با وزنه ای معادل 52 درصد وزن بدن آنها شروع شد و این وزنه ها به دم آنها ) درست 1-1 سانتی متر پایین تر از محل رویش مو( متصل شد. بار تمرین تا 122 درصد وزن بدن آنها تا پایان هفتة هشتم ادامه داشت. یک تکرار موفق وقتی بود که حیوان بتواند پله ها را کامل و در زمان حدود 8 ثانیه بالا رود. رت ها در پایین پله ها قرار می گرفتند و جهت بالا رفتن برانگیخته می شدند. فقط ضربات بسیار آهسته به دم آنها یا میله ها انگیزش برای بالارفتن بود. در این تحقیاق از هایچ گوناه پااداش و تحریاک غیرطبیعای مثالتحریک الکتریکی، آب سرد و فشار هوا استفاده نشد. یادگیری در مرحله آشناسازی و نیز تحریاک باا اساتفاده ازایجاد ضربه های کم شدت به میله های زیر پایة حیوان انگیزة بالا رفتن بود. تعداد تکرارها در هر جلسه 12 تکرار بود. وقتی یک حیوان به بالای دستگاه می رسید و یک تکرار را انجام می داد، بعد از 5 ثانیه برای تکارار بعادیآماده می شد. در شروع هر برنامه 1 ست 5 تکراری گرم کردن بدون وزنه انجام می دادند. پروتکل تمارین در هارروز در ست 5 تکراری انجام می گرفت که بعد از هر ست 1دقیقه استراحت در نظر گرفتاه شاد. در پایاان هار
116
جلسة تمرین حیوان یک ست تمرین 5 تکراری بدون وزنه با 6 دقیقه استراحت بین هر تکرار را برای سرد کردن انجام می داد. این برنامة تمرین 8 هفته ادامه داشت.
جراحی
تمام مراحل جراحی در یک جلسه انجام گرفت. موش ها 8 ساعت بعد از آخرین جلسة تمرین )برای از بین رفتن آثار حاد تمرین( از طریق تزریق کتامین )mg/kg 5 ( و گزالایسین )mg/kg 12( بیهوش و سپس کشته شدند. عضلة تاکنندة بلند انگشت شست پا1 )FHL( به عنوان عضلة تند انقباض و عضالة نعلای1 باه عناوان کناد انقباض خارج شدند. نمونههای خونی در دستگاه سانتریفیوژ به مدت 15 دقیقه در دمای درجة ساانتی گاراد وg8222 سانتریفیوژ شدند تا سلول های خونی خارج شوند. نمونه های عضلات و پلاساما باه سارعت در نیتاروژنمایع فریز شده و سپس به منظور آنالیزهای بیوشیمیایی بعدی در دمای 82- درجة سانتی گراد نگهداری شدند.

اندازه گیری S1P S1P و C17-S1P )یک آنالوگ 1 کربنای ازS1P ، باه عناوان اساتاندارد داخلای( از شارکتAvanti Polar Lipids (Alabaster, Al) خریداری شد. فتاال دی آلدهیاد6)OPA( )کاه بارای تشاخیصHPLC فلورومتری مناسب است( و آلکالین فسفاتاز از شرکت Sigma-Aldrich تهیه شد. دیگر محلول ها مثل اتانول ،بتا-مرکاپتواتانل5 از شرکت مرک خریداری شدند)Hohmburg, Germany(. تمام استانداردهای لیپیادی باهصورت محلول تهیه و در 12- درجة سانتی گراد نگهداری شدند. محتوای S1P موجود در فاز کلروفرم به وسایلةدسا تگاه کروموتا وگرافی ما ایع با ا فشا ار بااالا3)HPLC( بااا یا ک سیسااتم دتکتااور فلوروساانس اندازه گیری شد. براساس تحقیق مین و همکاران)1221( C17-S1P به عنوان استاندارد داخلی قبال از هماوژن

– Flexor Hallucis Longus (FHL)
– Soleus
– O-phthalaldehyde
– Alkaline Phosphatase
– β-Mercaptoethanol
– High pressure liquid chromatography (HPLC)
– Fluorescent detection
111
کردن نمونه ها اضافه شد)62( و نمونه ها در محیط یخی اولتراسونیک شدند. S1P موجود در نمونه هاا از طریاقآلکالین فسفاتاز به اسفنگوزین تبدیل شده و این محصولات از طریق OPA قبال از تزریاق باه دساتگاه مشاتق سازی شدند. دستگاه شامل یک دتکتاور فلوروسانس باا یاک ساتون18C باود )Aligent 1200 NanoLCseries(. محلول مورد استفاده استونیتریل)مارک ( و آب HPLC grade باه )vv9:1( باود . مقادار جریاان1 1میلی لیتر در دقیقه بود.
تعیین بیان mRNA
52 میلی گرم عضله با روش هاون کوبی به منظور استخراج کل RNA در 822 ماکرولیتر ترایزول شرکت Invitrogen هموژن شد. نسبت جذب نوری در طول موج 132 به جذب نوری در طول موج 182
)A260/A280( و نسبت جذب نوری در طول موج 132 به جذب نوری در طول موج 162 )A260/A230( نشان دهندة خلوص و آلودگی فنلی است. نمونه هایی که نسبت 280/260 آنها بین 8/1 تا 1 بود، در دمای 82- درجة سانتی گراد برای آزمایش ها بعدی نگهداری شد. cDNA با استفاده از کیت Revert AID First Fermantas, Germany( Strand cDNA Synthesis( ساخته و در دمای12- درجة سانتی گراد نگهداری شد. تعیین بیان mRNA نسبی از طریق Real-time RT-PCR با استفاده از دستگاه –Real
،18s انجام گرفت. توالی پرایمر برای ژن های )ABI Applied Biosystes 7300, Germany( Time
:Myogenin ،MyoD،S1P3،S1P ،S1P1
18S-F:GTTGGTTTTCGGAACTGAGGC,R:GTCGGCATCGTTTATGGTCG (204bp), S1P1(NM-017301)-F:TCATCGTCCGGCATTACAACTA, R:GAGTGAGCTTGTAGGT
GGTG(273bp),S1P2(NM-017192)- F:CGGAGGCACTGACTAATCAGATT,R:TCCCA
GCACTCAGGACACAGTTA(278pb),S1P3(XM-225216)-F:ACGCGCGCATCTACTTC
CT, R:TGGATCTCTCGGAGTTGTGGTT(69bp),MyoD(NM-176079)- F:ACTACAGCG
GCGACTCAGAC, R:GTGGAGATGCGCTCCACTAT(208bp), Myogenin (NM-)511710F:TGGTCCCAACCCAGGAGATCATTT,R:ACATATCCTCCACCGTGATGCTGT
(233bp).
110
کل حجم واکنش برابر 12 ماکرولیتر بود: 12 ماکرولیتر Master Mix Syber Green (Primer design,UK)، /1 ماکرولیتر مجموع دو پرایمر)Forward & Reverse(، 5 ماکرولیتر آب استریل RNAase Free و 3/6 ماکرولیتر از نمونه cDNA بود. مراحل PCR شامل یک مرحله دناتوراسیون1 در دمای 95 به مدت 15 ثانیه، یک دمای جفت شدن1 در 32 به مدت 15 ثانیه دمای 1 به مدت 62 ثانیه که برای 2 سیکل تکرار می شد، در پایان نیز یک دمای طویل شدن6 32 ثانیه ای در دمای 1 بود.
روش تجزیه وتحلیل دادهها
به منظور بررسی طبیعی بودن توزیع داده ها از آزمون کلوموگروف- اسمیرنوف و برای آنالیز آماری داده های به دست آمده از آزمون پارامتریک t-مستقل استفاده شد. برای بررسی همبستگی از آزمون پیرسون استفاده شد.

نتايج و يافتههاي تحقيق
در شروع مطالعه )2 8/2=p( و پس از 8 هفته تمرین مقاومتی ) 3 /2=p( تغییر معناداری در وزن حیوانات دو گروه مشاهده نشد. تمرین مقاومتی محتوای S1P پلاسما)221/2=p( را در مقایسه با گروه کنترل افزایش داد )جدول 1(.

جدول1_ مقدار وزن و S1P در پلاسمای موش های صحرایی بعد از 0 هفته تمرین مقاومتی در گروه های تمرین و کنترل
گروه تمرین گروه کنترل مقدار P t
وزن قبل از تمرین)گرم( وزن بعد از تمرین)گرم(
112972-641609

35
/
11
±
25
/
229

11
/
15
±
11
/
221

221
/
2

012
/
2

52
/
1
0
±
09
/
2
05

22
/
1

در این سایت فقط تکه هایی از این مطلب با شماره بندی انتهای صفحه درج می شود که ممکن است هنگام انتقال از فایل ورد به داخل سایت کلمات به هم بریزد یا شکل ها درج نشود

شما می توانید تکه های دیگری از این مطلب را با جستجو در همین سایت بخوانید

ولی برای دانلود فایل اصلی با فرمت ورد حاوی تمامی قسمت ها با منابع کامل

اینجا کلیک کنید

6
±
50
/
2
02

193
/
2

161
/
2

35

/

11

±

25

/

229

11


پاسخ دهید